pEGFP_D2A_tdTomato
(Plasmid #184045)

• Purpose: Expresses EGFP and tdTomato in mammalian cells under control of a CMV promoter by using a dual 2A peptide sequence (P2AT2A)
• Depositing Lab: Angela Pannier
• Publication: Kozisek et al J Biol Eng. 2023 Dec 7;17(1):76. doi: 10.1186/s13036-023-00394-0.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3300
• Total vector size (bp): 5840
• Modifications to backbone: F1 origin removed
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Enhanced Green Fluorescent Protein
• Alt name: EGFP
• Species: Synthetic
• Insert Size (bp): 717
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG
• 3′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG

Gene/Insert 2

• Gene/Insert name: tdTomato
• Species: Synthetic
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cggatctaccATGGTGAGCAAGGGCGA
• 3′ sequencing primer: GAATTAAGCTTTACTACTTGTACAGCTCGTCCATGC

Gene/Insert 3

• Gene/Insert name: Dual 2A Peptide Sequence
• Alt name: P2AT2A
• Species: Teschovirus and Thosea asigna virus
• Insert Size (bp): 119
• Promoter: CMV

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTGTACAAGtccggaggcagaaagcttggttcc
• 3′ sequencing primer: TGCTCACCATggtagatccgag

Resource Information

• Supplemental Documents:
  • pEGFP_D2A_tdTomato.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry