pPLV_C1
(Plasmid
#186415)
-
PurposeEndogenous murine RNase inhibitor production for cell-free lysate
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186415 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBEAST2
- Backbone size w/o insert (bp) 2876
- Total vector size (bp) 4250
-
Modifications to backboneReplaced the constitutive OR2-OR1-Pr promoter with the T7 promoter
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMurine RNase Inhibitor
-
Alt namemRI
-
Alt nameUniprot #Q91VI7
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1374
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCGGATACCCTTACTCTGTTGAAAAC
- 3′ sequencing primer CACCAACGGGTTATTGATAGAACGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.05.02.489947v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPLV_C1 was a gift from Jerome Bonnet (Addgene plasmid # 186415 ; http://n2t.net/addgene:186415 ; RRID:Addgene_186415) -
For your References section:
Evaluating and mitigating clinical samples matrix effects on TX-TL cell-free performance. Voyvodic PL, Conejero I, Mesmoudi K, Renard E, Courtet P, Cattoni DI, Bonnet J. Sci Rep. 2022 Aug 12;12(1):13785. doi: 10.1038/s41598-022-17583-4. 10.1038/s41598-022-17583-4 PubMed 35962056