Addgene - Thy1-Brainbow-1.0 L Plasmid Data

Plasmid 18725: Thy1-Brainbow-1.0 L

Gene/insert name:
dTomato ; EYFP ; mCerulean
Vector backbone:
pUC18+Thy1 promoter
(Search Vector Database)
Vector type:
Mammalian Expression, Mouse Targeting, Cre/Lox
Backbone size w/o insert (bp):
9188
Cloning site 5':
NheI / XhoI
Site destroyed during cloning:
Yes
Cloning site 3':
SspI / XhoI
Site destroyed during cloning:
Yes
5' sequencing primer:
Thy1 F1 primer (TCTGAGTGGCAAAGGACCTTAGG) List of Sequencing Primers
Bacterial resistance(s)
Ampicillin
Growth strain(s)
DH5alpha
Growth temperature (℃):
37
High or low copy:
Unknown
Sequence: View sequences (2)
Map:
View map
Supplemental document:
Brainbow Plasmids Information (application/pdf)
Principal Investigator:
Joshua Sanes
Terms and Licenses:
MTA
Clontech Limited Use Label License

Comments:

The Author's Map is a representative Brainbow 1.0 construct. The actual fluorescent genes are as indicated in the Gene/insert name.

Thy1 promoter. To linearize plasmid and remove vector sequences, EcoRI + PvuI , or alternatively NotI + PvuI are used (Note that PvuI also cuts inside the pUC18 vector).

Please see attached PDF for important additional information.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Transgenic strategies for combinatorial expression of fluorescent proteins in the nervous system. Livet et al (Nature. 2007 Nov 1. 450(7166):56-62. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 18725" in your Materials and Methods section.