1
Plasmid Cart
Login to add to cart
Recently Visited
Plasmid 18727: Thy1-Brainbow-2.1 R
  • hrGFPII-NLS ; EYFP ; tdimer2 ; M-mCerulean

  • pUC18+Thy1 promoter
    (Search Vector Database)

  • Mammalian Expression, Mouse Targeting, Cre/Lox

  • 9188

  • NheI / XhoI

  • Yes

  • HindIII / XhoI

  • Yes

  • Thy1 F1 primer (TCTGAGTGGCAAAGGACCTTAGG) List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • View sequences (2)
  • View map

  • Brainbow Plasmids Information (application/pdf)

  • Joshua Sanes

  • MTA
    Clontech Limited Use Label License

Comments: 

The Author's Map is a representative Brainbow 2.1 construct (M= membrane tethered).

Thy1 promoter. To linearize plasmid and remove vector sequences, EcoRI + PvuI , or alternatively NotI + PvuI are used (Note that PvuI also cuts inside the pUC18 vector).

Please see attached PDF for important additional information.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Transgenic strategies for combinatorial expression of fluorescent proteins in the nervous system. Livet et al (Nature. 2007 Nov 1. 450(7166):56-62. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 18727" in your Materials and Methods section.