Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHR ErbB2-CD3ε-FusionRed
(Plasmid #188628)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 188628 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ERBB2
  • Alt name
    HER2
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    4815
  • Entrez Gene
    ERBB2 (a.k.a. CD340, HER-2, HER-2/neu, HER2, MLN 19, MLN-19, NEU, NGL, TKR1, VSCN2, c-ERB-2, c-ERB2, p185(erbB2))
  • Promoter SFFV
  • Tag / Fusion Protein
    • CD3ε-FusionRed (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ccgacagactgagtcgcccggg
  • 3′ sequencing primer ccagaggttgattatcgataagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.08.13.503850 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR ErbB2-CD3ε-FusionRed was a gift from Jared Toettcher (Addgene plasmid # 188628 ; http://n2t.net/addgene:188628 ; RRID:Addgene_188628)
  • For your References section:

    pYtags enable spatiotemporal measurements of receptor tyrosine kinase signaling in living cells. Farahani PE, Yang X, Mesev E, Fomby K, Bashor C, Nelson CM, Toettcher JE. bioRxiv (2022) 10.1101/2022.08.13.503850