1
Plasmid 19167: pQCXIN X2/pTER shEGFP#1 (w491-1)
  • Retroviral eGFP shRNA #2 (H1/TO promoter), 3’LTR insertion, Neo

  • Enhanced green fluorescent protein shRNA #2

  • shGFP #2

  • 65

  • pQCXIN
    (Search Vector Database)

  • Clontech

  • Retroviral, RNAi

  • 7721

  • Bgl II

  • Yes

  • Hind III

  • No

  • n/a List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • TOP10F', 37oC

  • High Copy

  • Neomycin

  • View sequences (2)
  • View map

  • Eric Campeau

  • UBMTA
    Ancillary Agreement for Plasmids Containing FP Materials

Comments: 

shRNa oligo seq 5'-CGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTCTTTTT

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: A versatile viral system for expression and depletion of proteins in mammalian cells. Campeau et al (PLoS One. 2009 Aug 6;4(8):e6529. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 19167" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only