Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

ploxP unc-119
(Plasmid #19185)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 19185 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMOD4
  • Backbone manufacturer
    Epicentre
  • Backbone size w/o insert (bp) 2100
  • Vector type
    Recombineering

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    EC100pir116
  • Growth instructions
    EC100pir116 or other pir containing bacteria
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    unc-119
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    5733
  • Mutation
    contains loxP site just 5' to ApaI site
  • Entrez Gene
    unc-119 (a.k.a. CELE_M142.1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GTCAGTGAGCGAGGAAGCGGAAG
  • 3′ sequencing primer ATTCAGGCTGCGCAACTGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    unc-119 sequence is from pDP#MM016b
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Few mismatches between Addgene and depositor sequence are in the 3' UTR and shouldn't have any impact on plasmid's function

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ploxP unc-119 was a gift from Al Fisher (Addgene plasmid # 19185 ; http://n2t.net/addgene:19185 ; RRID:Addgene_19185)
  • For your References section:

    A simplified, robust, and streamlined procedure for the production of C. elegans transgenes via recombineering. Zhang Y, Nash L, Fisher AL.. BMC Dev Biol. 2008 Dec 30;8(1):119. 10.1186/1471-213X-8-119 PubMed 19116030