eGFP Y93H CC editing reporter
(Plasmid #198885)

• Purpose: Express eGFP fluorescence after Y93H correction and mCherry as transfection control
• Depositing Lab: Reuben Harris
• Publication: Rieffer et al CRISPR J. 2023 Oct;6(5):430-446. doi: 10.1089/crispr.2023.0027. Epub 2023 Sep 6.

Backbone

• Vector backbone: pLenti-CMV-mCherry-T2A-eGFP-Gly92(GGT)-His93(CAC)-Hygro
• Backbone size w/o insert (bp): 11182
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: enhanced green fluorescent protein
• Alt name: eGFP
• Species: Synthetic
• Insert Size (bp): 1503
• Mutation: Y93H, Gly92(GGT-to-GGC)
• Promoter: CMV

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ctggctaccggtatggtgagcaagggcgagg
• 3′ sequencing primer: CTTGTACTCGAGATCTGCACCGGGCTTGTACAGCTCGTCCATGCC

Resource Information

• Supplemental Documents:
  • eGFP Y93H CC editing reporter.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Also expresses mCherry (with T2A cleavage site)