pRRL-VinculinCS
(Plasmid
#200309)
-
PurposeLentivirus vector expressing vinculin with FRET conformational sensor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200309 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRRL
- Backbone size w/o insert (bp) 4644
- Total vector size (bp) 11483
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVinculinCS
-
Alt nameVinCS
-
SpeciesG. gallus (chicken), Synthetic
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GTAAACGGCCACAAGTTCAGC
- 3′ sequencing primer GACGTAGCCTTCGGGCAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL-VinculinCS was a gift from Brenton Hoffman (Addgene plasmid # 200309 ; http://n2t.net/addgene:200309 ; RRID:Addgene_200309) -
For your References section:
Identifying constitutive and context-specific molecular-tension-sensitive protein recruitment within focal adhesions. Tao A, LaCroix AS, Shoyer TC, Venkatraman V, Xu KL, Feiger B, Hoffman BD. Dev Cell. 2023 Mar 10:S1534-5807(23)00074-6. doi: 10.1016/j.devcel.2023.02.015. 10.1016/j.devcel.2023.02.015 PubMed 36924770