Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-hSyn-GRAB-rDA3m
(Plasmid #208702)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 208702 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GPCR activation based dopamine (DA) sensor GRAB_rDA3m
  • Alt name
    GRAB_rDA3m
  • Alt name
    rDA3m
  • Species
    H. sapiens (human)
  • Promoter hSyn

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACGGGCGCGACCATCTGCGC
  • 3′ sequencing primer CATTAAAGCAGCGTATCC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.08.24.554559 for biorxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-GRAB-rDA3m was a gift from Yulong Li (Addgene plasmid # 208702 ; http://n2t.net/addgene:208702 ; RRID:Addgene_208702)
  • For your References section:

    Improved green and red GRAB sensors for monitoring dopaminergic activity in vivo. Zhuo Y, Luo B, Yi X, Dong H, Miao X, Wan J, Williams JT, Campbell MG, Cai R, Qian T, Li F, Weber SJ, Wang L, Li B, Wei Y, Li G, Wang H, Zheng Y, Zhao Y, Wolf ME, Zhu Y, Watabe-Uchida M, Li Y. Nat Methods. 2023 Nov 30. doi: 10.1038/s41592-023-02100-w. 10.1038/s41592-023-02100-w PubMed 38036855