pAAV-hSyn-DIO-GRAB-rDA3m
(Plasmid
#208708)
-
PurposeExpresses the genetically-encoded fluorescent dopamine (DA) sensor GRAB_rDA3m in neurons in a cre-dependent manner
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208708 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPCR activation based dopamine (DA) sensor GRAB_rDA3m
-
Alt nameGRAB_rDA3m
-
Alt namerDA3m
-
SpeciesH. sapiens (human)
- Promoter hSyn
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGGGCGCGACCATCTGCGC
- 3′ sequencing primer CATTAAAGCAGCGTATCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.08.24.554559 for biorxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-DIO-GRAB-rDA3m was a gift from Yulong Li (Addgene plasmid # 208708 ; http://n2t.net/addgene:208708 ; RRID:Addgene_208708) -
For your References section:
Improved green and red GRAB sensors for monitoring dopaminergic activity in vivo. Zhuo Y, Luo B, Yi X, Dong H, Miao X, Wan J, Williams JT, Campbell MG, Cai R, Qian T, Li F, Weber SJ, Wang L, Li B, Wei Y, Li G, Wang H, Zheng Y, Zhao Y, Wolf ME, Zhu Y, Watabe-Uchida M, Li Y. Nat Methods. 2023 Nov 30. doi: 10.1038/s41592-023-02100-w. 10.1038/s41592-023-02100-w PubMed 38036855