Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

T/Brachyury-eGFP Rex Neo
(Plasmid #21222)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 21222 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    SIN18
  • Backbone size w/o insert (bp) 7838
  • Vector type
    Lentiviral
  • Selectable markers
    Neomycin resistanct marker driven by Rex-1 promoter

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Brachyury promoter
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    644
  • Tag / Fusion Protein
    • eGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site claI (not destroyed)
  • 3′ cloning site ageI (not destroyed)
  • 5′ sequencing primer CTTGATGCCGTTCTTCTGCTT - 3' sequencing only
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    T/Brachyury-eGFP Rex Neo was a gift from Mark Mercola (Addgene plasmid # 21222 ; http://n2t.net/addgene:21222 ; RRID:Addgene_21222)
  • For your References section:

    Lentiviral vectors and protocols for creation of stable hESC lines for fluorescent tracking and drug resistance selection of cardiomyocytes. Kita-Matsuo H, Barcova M, Prigozhina N, Salomonis N, Wei K, Jacot JG, Nelson B, Spiering S, Haverslag R, Kim C, Talantova M, Bajpai R, Calzolari D, Terskikh A, McCulloch AD, Price JH, Conklin BR, Chen HS, Mercola M. PLoS ONE. 2009 . 4(4):e5046. 10.1371/journal.pone.0005046 PubMed 19352491