-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21339 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1
-
Backbone manufacturerAvailable from Addgene
- Backbone size w/o insert (bp) 7032
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Growth instructionsXL10 Gold Ultracompetent Cells from Stratagene or nStb13. Grow in SOC media at 37oC
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameraptor shRNA 1
-
Alt nameraptor
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)60
-
GenBank IDNM_028898
-
Entrez GeneRptor (a.k.a. 4932417H02Rik, Rap, Raptor, mKIAA1303)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
References
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
mouse raptor shRNA 1.
shRNA oligo sequence is 5'- CCGGCCTCATCGTCAAGTCCTTCAACTCGAGTTGAAGGACTTGACGATGAGGTTTTTG -3'
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO mouse shRNA 1 raptor was a gift from David Sabatini (Addgene plasmid # 21339 ; http://n2t.net/addgene:21339 ; RRID:Addgene_21339) -
For your References section:
An ATP-competitive mammalian target of rapamycin inhibitor reveals rapamycin-resistant functions of mTORC1. Thoreen CC, Kang SA, Chang JW, Liu Q, Zhang J, Gao Y, Reichling LJ, Sim T, Sabatini DM, Gray NS. J Biol Chem. 2009 Mar 20. 284(12):8023-32. 10.1074/jbc.M900301200 PubMed 19150980