This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

scramble shRNA
(Plasmid #1864)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 1864 Plasmid sent as bacteria in agar stab 1 $65
Lentiviral Prep 1864-LV Virus (1mL at titer ≥ 1x10⁶ TU/mL)
and Plasmid. More Information
$250

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLKO.1
  • Backbone manufacturer
    Stewart SA, RNA 2003 Apr; 9(4):493-501.
  • Backbone size w/o insert (bp) 7032
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Growth instructions
    XL10-Gold Ultracompetent Cells from Stratagene. 37oC.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    scramble
  • Insert Size (bp)
    60

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

shRNA for use as a negative control. Sequence of hairpin is:CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG. For packaging, please use pCMV-dR8.2 dvpr (Addgene plasmid #8455) and pCMV-VSVG (Addgene plasmid #8454).

Please note that the 5' cloning site, AgeI, is typically destroyed during the shRNA cloning. Depending on the specific shRNA sequence, the site can occasionally be restored. AgeI is present in this plasmid.

Information for Lentiviral Prep (Catalog # 1864-LV) ( Back to top )

Purpose

Ready-to-use Lentiviral Prep particles produced from scramble shRNA (#1864). In addition to the viral particles, you will also receive purified scramble shRNA plasmid DNA.

Lentiviral particles carrying a scramble shRNA and puromycin resistance.

Delivery

  • Volume 1mL
  • Titer ≥1x10⁶ TU/mL
  • Pricing $220 USD for preparation of 1mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer DMEM +10% FBS
  • Selectable Marker Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Colony formation assay: A549 cells were transduced with serial dilutions of 1864-LV and treated with puromycin. Puromycin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet, and counted.
Notes:
  • PCR confirmation of insert: PCR was carried out with primers targeting the hU6 and PGK promoters. The PCR product was visualized on an agarose gel for size confirmation, purified and the shRNA sequence was confirmed by Sanger sequencing.
    Forward Primer: hU6-F GAGGGCCTATTTCCCATGATT
    Reverse Primer: O_PGK1b-R GAACGGACGTGAAGAATGTG

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    scramble shRNA was a gift from David Sabatini (Addgene plasmid # 1864)
  • For your References section:

    Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Sarbassov DD, Guertin DA, Ali SM, Sabatini DM. Science 2005 Feb 18;307(5712):1098-101. 10.1126/science.1106148 PubMed 15718470