1
Plasmid 21970: CMV-d2eGFP-20
Comments: 

miR-20 bulged Renilla luciferase reporter and CMV sponge: UACCUGCACUCGCGCACUUUA

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Ebert et al (Nat Methods. 2007 Sep . 4(9):721-6. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21970" in your Materials and Methods section.