|
Plasmid
21970:
CMV-d2eGFP-20
|
Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result. MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Ebert et al (Nat Methods. 2007 Sep . 4(9):721-6. PubMed) Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21970" in your Materials and Methods section. |
miR-20 bulged Renilla luciferase reporter and CMV sponge: UACCUGCACUCGCGCACUUUA