(Plasmid #21970)

Available to Academic and Nonprofits Only


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.


  • Gene/Insert name
    CMV d2eGFP miR-20 sponge
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

miR-20 bulged Renilla luciferase reporter and CMV sponge: UACCUGCACUCGCGCACUUUA

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-d2eGFP-20 was a gift from Phil Sharp (Addgene plasmid # 21970)
  • For your References section:

    MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Ebert MS, Neilson JR, Sharp PA. Nat Methods. 2007 Sep . 4(9):721-6. 10.1038/nmeth1079 PubMed 17694064