1
Plasmid 21967: CMV-d2eGFP-cxcr4
  • CMV d2eGFP CXCR4 control sponge

  • 175

  • pcDNA5
    (Search Vector Database)

  • Mammalian Expression

  • 5000

  • XhoI

  • No

  • ApaI

  • No

  • n/a List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (3)
  • Phil Sharp

  • MTA

Comments: 

From Supplementary Table 1:
"CXCR4 bulged Renilla luciferase reporter, 7 sites or 1 site; CMV sponge, 7 sites; U6 spong, 4 sites:
AAGUUUUCAGAAAGCUAACA"

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Ebert et al (Nat Methods. 2007 Sep . 4(9):721-6. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21967" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only