1
Plasmid 21967: CMV-d2eGFP-cxcr4
Comments: 

From Supplementary Table 1:
"CXCR4 bulged Renilla luciferase reporter, 7 sites or 1 site; CMV sponge, 7 sites; U6 spong, 4 sites:
AAGUUUUCAGAAAGCUAACA"

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: MicroRNA sponges: competitive inhibitors of small RNAs in mammalian cells. Ebert et al (Nat Methods. 2007 Sep . 4(9):721-6. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 21967" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only