pQUAST-mtdT-3XHA
(Plasmid #24354)

• Depositing Lab: Liqun Luo
• Publication: Potter et al Volume 141, Issue 3, 536-548, 30 April 2010

Backbone

• Vector backbone: pQUAST
• Backbone size w/o insert (bp): 9000
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mtDT-3XHA
• Insert Size (bp): 1000

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (unknown if destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: pCasper-F

Resource Information

• Reference:
  • pQUAST-mtdT-3XHA (GenBank)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The N-terminal membrane tag on tdTomato contains
8 amino acids that direct myristoylation and palmitoylation (Muzumdar et al., 2007). 3 copies of the
HA tag were PCR amplified from pTHW (Drosophila Genomics Resource Center) and included a 5’ BsrGI restriction site and a 3’ EcoRI restriction site preceded by the TAA stop codon (5’ 
oligo:TTATGTACAAGTACCCATACGATGTTCCTGACTATGC; 3’ oligo: 
TAAGAATTCTTAAGCGTAATCTGGAACGTCATATGGATAGG). pSN20-mtdT (Muzumdar et al.,
2007) was digested with BsrGI and EcoRI and the HA PCR fragment was ligated into this vector to generate pSN20-mtdT-3xHA. This vector was then digested with XhoI and partially digested with
BamHI and cloned into pQUAST to generate pQUAST-mtdT-
3xHA. The mtdT-3xHA reporter in vivo is as good as
mCD8-GFP in labeling dendritic and axonal processes, or in labeling imaginal disc tissues.
However, it does not label neuronal cell bodies as well as mCD8-GFP as most of the mtdT-3xHA signal is localized to the plasma membrane surface whereas mCD8-GFP, which also localizes to
intracellular membranes, allows for the cell soma to be better visualized.