1
Plasmid 24554: pFloxin-IRES
  • None

  • pBluescript
    (Search Vector Database)

  • Mouse Targeting, Cre/Lox

  • 4512

  • tcggtgcacatgctttacat List of Sequencing Primers

  • Ampicillin

  • Stbl2

  • 37

  • Stbl2 (Invitrogen) or other RecA- strain 37 degrees in LB media

  • Low Copy

  • View sequences (2)
  • View map

  • Jeremy Reiter

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Floxin, a resource for genetically engineering mouse ESCs. Singla et al (Nat Methods. 2010 Jan . 7(1):50-2. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 24554" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only