-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 24561 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRRL-sin18PPT CAG-ires-GFP
- Backbone size w/o insert (bp) 9200
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Growth instructionsXL-10 Gold, Stratagene
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBAF155
-
Alt nameSmarcc1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3300
-
GenBank IDNM_009211
-
Entrez GeneSmarcc1 (a.k.a. AI115498, BAF15, BAF155, Rsc8, SR, SRG3, ms, msp3)
-
Tag
/ Fusion Protein
- Flag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Age1 (not destroyed)
- 3′ cloning site Pst1 (not destroyed)
- 5′ sequencing primer gctaaccatgttcatgccttc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOpen Biosystems cDNA clone
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL CAGpNFlag BAF155 ires GFP was a gift from Jerry Crabtree (Addgene plasmid # 24561 ; http://n2t.net/addgene:24561 ; RRID:Addgene_24561) -
For your References section:
An embryonic stem cell chromatin remodeling complex, esBAF, is essential for embryonic stem cell self-renewal and pluripotency. Ho L, Ronan JL, Wu J, Staahl BT, Chen L, Kuo A, Lessard J, Nesvizhskii AI, Ranish J, Crabtree GR. Proc Natl Acad Sci U S A. 2009 Mar 31. 106(13):5181-6. 10.1073/pnas.0812889106 PubMed 19279220