1
Plasmid 24969: pSICO-Flpo
  • Flp recombinase

  • 1300

  • pSico
    (Search Vector Database)

  • Addgene Plasmid 11578

  • Mammalian Expression, Lentiviral, RNAi, Cre/Lox

  • 6739

  • StuI

  • No

  • HpaI

  • No

  • mPGK-F List of Sequencing Primers

  • WPRE-R (CATAGCGTAAAAGGAGCAACA)

  • Ampicillin

  • Stbl3

  • 37

  • Stbl3

  • High Copy

  • View sequences (2)
  • View map

  • Tyler Jacks

  • MTA

Comments: 

pSico-Flpo allows for conditional (Cre-Lox), stable expression of shRNAs for RNA interference in cells and transgenic mice. Addition of Cre TURNS ON shRNA expression.
The shRNA coding oligos have to be cloned into the HpaI and XhoI restriction sites. Oligo design information can be found on the author's map or on the Jacks Lab website http://web.mit.edu/ccr/labs/jacks/protocols/pSi...

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Tissue-specific p19Arf regulation dictates the response to oncogenic K-ras. Young et al (Proc Natl Acad Sci U S A. 2010 Jun 1. 107(22):10184-9. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 24969" in your Materials and Methods section.