Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #24969)


Item Catalog # Description Quantity Price (USD)
Plasmid 24969 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Addgene Plasmid 11578
  • Backbone size w/o insert (bp) 6739
  • Vector type
    Mammalian Expression, Lentiviral, RNAi, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
  • Copy number
    High Copy


  • Gene/Insert name
    Flp recombinase
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site StuI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer mPGK-F
  • 3′ sequencing primer WPRE-R (CATAGCGTAAAAGGAGCAACA)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid

Depositor Comments

pSico-Flpo allows for conditional (Cre-Lox), stable expression of shRNAs for RNA interference in cells and transgenic mice. Addition of Cre TURNS ON shRNA expression.
The shRNA coding oligos have to be cloned into the HpaI and XhoI restriction sites. Oligo design information can be found on the author's map or on the Jacks Lab website

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSICO-Flpo was a gift from Tyler Jacks (Addgene plasmid # 24969 ; ; RRID:Addgene_24969)
  • For your References section:

    Tissue-specific p19Arf regulation dictates the response to oncogenic K-ras. Young NP, Jacks T. Proc Natl Acad Sci U S A. 2010 Jun 1. 107(22):10184-9. 10.1073/pnas.1004796107 PubMed 20479239