Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

Puro.Cre empty vector
(Plasmid #17408)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 17408 Plasmid sent as bacteria in agar stab 1 $65
Lentiviral Prep 17408-LV Virus (1 mL at titer ≥ 1x10⁶ TU/mL)
and Plasmid. More Information
$250

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Puro.Cre
  • Backbone manufacturer
    Jacks Lab
  • Backbone size (bp) 9200
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

Resource Information

Depositor Comments

Puro.Cre was initially generated by amplification of PuroR from MSCV.Puro (Clontech) with PuroF (5’-CGCTGCGCCGAATTCATGACCGAGTACAAGCCCACG-3’) and PuroR (5’-TAAGCGGCCGCTCGAGTCAGGCACCGGGCTTGCGGGTC-3’), digestion with EcoRI and NotI and cloning into UbC.Luciferase.PGK.Cre to generate Puro.Cre.

For lentiviral packaging, you can use pCMV-delta-8.2 (Addgene #8455) and pCMV-VSV-G (Addgene #8454).

Information for Lentiviral Prep (Catalog # 17408-LV) ( Back to top )

Purpose

Ready-to-use Lentiviral Prep particles produced from Puro.Cre empty vector (#17408). In addition to the viral particles, you will also receive purified Puro.Cre empty vector plasmid DNA.

Lentiviral particles carrying CRE recombinase and puromycin resistance.

Delivery

  • Volume 1 mL
  • Titer ≥1x10⁶ TU/mL
  • Pricing $220 USD for preparation of 1 mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer DMEM +10% FBS
  • Selectable Marker Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Cell survival assay relative to standard curve: Lenti-X 293T cells were serially transduced with 17408-LV or a control virus of known titer. 48h after transduction, cells were selected with puromycin, expanded for 2 days and resistant cells quantified via a dye-based cell viability assay. A standard curve was generated from the serial dilutions of the control virus and used to determine the titer of 17408-LV.
Notes:
  • PCR confirmation of insert: PCR was carried out with primers targeting CRE and WPRE. The PCR product was visualized on an agarose gel for size confirmation.
    Forward Primer: CMV-F TTTACGGCGCTAAGGATGAC
    Reverse Primer: WPRE-R CATAGCGTAAAAGGAGCAACA
  • Confirmation of Cre activity: Expression of Cre following transduction with 17408-LVC was confirmed using a Cre reporter assay.
  • Toxicity: Please note that that Cre expression is toxic in some cell lines due to cryptic loxP sites in the genome. If you are unsure how your cell line of interest tolerates Cre expression, consider transducing with a range MOIs or transducing an array of cell lines.

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Puro.Cre empty vector was a gift from Tyler Jacks (Addgene plasmid # 17408)
  • For your References section:

    Suppression of non-small cell lung tumor development by the let-7 microRNA family. Kumar MS, Erkeland SJ, Pester RE, Chen CY, Ebert MS, Sharp PA, Jacks T. Proc Natl Acad Sci U S A. 2008 Feb 28. ():. 10.1073/pnas.0712321105 PubMed 18308936