pAL119-hCTLA4-Ig
(Plasmid #25100)

• Depositing Lab: Maria Castro
• Publication: Guillot et al Blood. 2003 Apr 15. 101(8):3325-33.

Backbone

• Vector backbone: pAL119
• Backbone size w/o insert (bp): 7337
• Vector type: Adenoviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: ytotoxic T-murine Lymphocyte Antigen 4
• Alt name: mCTLA4-IGHG1
• Alt name: CTLA4
• Species: M. musculus (mouse)
• Insert Size (bp): 2095
• Entrez Gene: Ctla4 (a.k.a. Cd152, Ctla-4, Ly-56)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (destroyed during cloning)
• 3′ cloning site: BamHI (destroyed during cloning)
• 5′ sequencing primer: For tk 656- 5' AGCGGTTTGACTCACGGGGATTTC 3'
• 3′ sequencing primer: rev tk 2404 -5' CCTGGTGCGGGTCTCATCGTA 3'

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry