-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 25639 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1 puro
- Backbone size w/o insert (bp) 7032
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePTEN-shRNA-3001
-
gRNA/shRNA sequenceCCGGCCACAAATGAAGGGATATAAACTCGAGTTTATATCCCTTCATTTGTGGTTTTT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)42
-
GenBank IDNM_000314
-
Entrez GenePTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe RNAi Consortium (TRC), MISSION shRNA
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO-PTEN-shRNA-3001 was a gift from Todd Waldman (Addgene plasmid # 25639 ; http://n2t.net/addgene:25639 ; RRID:Addgene_25639) -
For your References section:
Activation of p53-dependent growth suppression in human cells by mutations in PTEN or PIK3CA. Kim JS, Lee C, Bonifant CL, Ressom H, Waldman T. Mol Cell Biol. 2007 Jan . 27(2):662-77. 10.1128/MCB.00537-06 PubMed 17060456