Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

mCol.2lox4F2A targeting construct
(Plasmid #25795)


Item Catalog # Description Quantity Price (USD)
Plasmid 25795 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 10600
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer tagagaaaagtgaaagtcgagtttac
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCol.2lox4F2A targeting construct was a gift from Rudolf Jaenisch (Addgene plasmid # 25795)
  • For your References section:

    Single-gene transgenic mouse strains for reprogramming adult somatic cells. Carey BW, Markoulaki S, Beard C, Hanna J, Jaenisch R. Nat Methods. 2010 Jan . 7(1):56-9. 10.1038/nmeth.1410 PubMed 20010831