1
Plasmid 20321: TetO-FUW-OSKM
  • Oct-4

  • Sox2

  • Klf4

  • Myc

  • 5000

  • M. musculus (mouse)

  • Pou5f1 (NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
    Sox2 (AL606746.1, Sox-2, lcc, ysb)
    Klf4 (RP23-322L22.2, EZF, Gklf, Zie)
    Myc (AU016757, Myc2, Niard, Nird, bHLHe39)

  • FUW
    (Search Vector Database)

  • homemade

  • Lentiviral

  • 8376

  • EcoRI

  • No

  • EcoRI

  • No

  • ACTTTGCAGCCTGAGGGCCA List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • TOP10, 37C

  • High Copy

  • Zeocin

  • View sequences (5)
  • View map

  • Notes from Addgene (2)

  • Rudolf Jaenisch

  • MTA
    Tet Systems Limited Use Label License

Comments: 

Please note that this plasmid has an extra XhoI site upstream of the TRE element. You can find the additional XhoI site in Addgene's sequence with mOct4-R primer. Please view Addgene's test digest with XhoI for the correct band pattern.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Reprogramming of murine and human somatic cells using a single polycistronic vector. Carey et al (Proc Natl Acad Sci U S A. 2009 Jan 6. 106(1):157-62. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 20321" in your Materials and Methods section.