Plasmid 20328: FUW-OSKM
  • Lentiviral plasmid expressing mouse Oct4, Sox2, Klf4 and cMyc for iPS cell generation

  • Oct4-P2A-Sox2-T2A-Klf4-E2A-cMyc

  • 5000

  • M. musculus (mouse)

  • FUW (Lenti-Lox-Ubi)
    (Search Vector Database)

  • homemade

  • Lentiviral

  • 7222

  • EcoRI

  • No

  • EcoRI

  • No

  • ACTTTGCAGCCTGAGGGCCA List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • TOP10, 37C

  • High Copy

  • View sequences (4)
  • Rudolf Jaenisch


Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Reprogramming of murine and human somatic cells using a single polycistronic vector. Carey et al (Proc Natl Acad Sci U S A. 2009 Jan 6. 106(1):157-62. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 20328" in your Materials and Methods section.