1
Plasmid 25812: pWPI_SPbFGF
  • pWPI_SPbFGF

  • FGF2

  • 620

  • H. sapiens (human)

  • FGF2 (BFGF, FGF-2, FGFB, HBGF-2)

  • Ig signal peptide in N-terminal of human FGF2

  • pWPI
    (Search Vector Database)

  • Lentiviral

  • 11101

  • PmeI

  • Yes

  • PmeI

  • Yes

  • attctcaagcctcagacagt List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • HB101 or Top10 are recommended for growing lentivectors

  • High Copy

  • View sequences (2)
  • View map

  • Jozsef Kiss

  • Patrick Salmon

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Expression of FGF-2 in neural progenitor cells enhances their potential for cellular brain repair in the rodent cortex. Dayer et al (Brain. 2007 Nov . 130(Pt 11):2962-76. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 25812" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only