-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 25997 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1
- Backbone size w/o insert (bp) 6543
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsStbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre recombinase
-
Alt namenlsCre
-
Speciesbacteriophage
-
Insert Size (bp)1053
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer CCTTCACCGAGGGCCTATTTC (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
Depositor Comments
Second AgeI site is introduced preventing AgeI-EcoRI shRNA subcloning. TRC library shRNAs can be subcloned as an AccI fragment.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LV-Cre pLKO.1 was a gift from Elaine Fuchs (Addgene plasmid # 25997 ; http://n2t.net/addgene:25997 ; RRID:Addgene_25997) -
For your References section:
Rapid functional dissection of genetic networks via tissue-specific transduction and RNAi in mouse embryos. Beronja S, Livshits G, Williams S, Fuchs E. Nat Med. 2010 Jul . 16(7):821-7. 10.1038/nm.2167 PubMed 20526348