1
Plasmid 26213: pJFRC-MUH
  • None

  • pBDP
    (Search Vector Database)

  • Insect Expression

  • 7831

  • BglII

  • No

  • XbaI

  • No

  • hsp70 F: GAGCGCCGGAGTATAAATAGAG List of Sequencing Primers

  • SV40 R: CCATTCATCAGTTCCATAGG

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • View map

  • Author's PDF Map of pJFRC-MUH (application/pdf)

  • Gerald Rubin

  • UBMTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Refinement of Tools for Targeted Gene Expression in Drosophila. Pfeiffer et al (Genetics. 2010 Aug 9. ():. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 26213" in your Materials and Methods section.