Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCBFRE-(mt)-luc
(Plasmid #26896)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 26896 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CBFRE
  • Alt name
    CBF1-responsive element
  • Insert Size (bp)
    144
  • Mutation
    Mutated CBF1 sites (see note)
  • Tag / Fusion Protein
    • Luciferase (C terminal on backbone)

Cloning Information

Resource Information

Depositor Comments

CBFRE: four (mutated) CBF1-binding elements from EBV (see Hsieh MCB 1996, 16:952) and the basal simian virus 40 (SV40) promoter upstream of Luciferase. The sequence of the mutated CBF1 binding element is (GATCTGGTGTAAA CACGGGCTTGGAAAAAATTTATG).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCBFRE-(mt)-luc was a gift from Nicholas Gaiano (Addgene plasmid # 26896 ; http://n2t.net/addgene:26896 ; RRID:Addgene_26896)
  • For your References section:

    Notch signaling activation in human embryonic stem cells is required for embryonic, but not trophoblastic, lineage commitment. Yu X, Zou J, Ye Z, Hammond H, Chen G, Tokunaga A, Mali P, Li YM, Civin C, Gaiano N, Cheng L. Cell Stem Cell. 2008 May 8. 2(5):461-71. 10.1016/j.stem.2008.03.001 PubMed 18462696