Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

AAV-CAG-hChR2_tdTomato
(Plasmid #28015)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 28015 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Stbl2
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    humanized ChR2-tdTomato
  • Alt name
    hChR2-tdTomato
  • Insert Size (bp)
    2363
  • Tag / Fusion Protein
    • tdTomato

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TCGGCTTCTGGCGTGTGACCGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

with ITRs, this vector is easy to have recombination. Check with multiple restriction digestions.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-CAG-hChR2_tdTomato was a gift from Karel Svoboda (Addgene plasmid # 28015)
  • For your References section:

    Long-Range Neuronal Circuits Underlying the Interaction between Sensory and Motor Cortex. Mao T, Kusefoglu D, Hooks BM, Huber D, Petreanu L, Svoboda K. Neuron. 2011 Oct 6;72(1):111-23. 10.1016/j.neuron.2011.07.029 PubMed 21982373