This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #28162)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 28162 Standard format: Plasmid sent in bacteria as agar stab 1 $65 *

* Login to view industry pricing.


  • Vector backbone
  • Backbone manufacturer
  • Vector type
    Baculovirus expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    WD repeat domain 61
  • Alt name
    PDB: 3OW8
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    WDR61 (a.k.a. REC14, SKI8)
  • Promoter polyhedrin
  • Tag / Fusion Protein
    • His tag with TEV cleavage (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ cloning site ligation-independent cloning (unknown if destroyed)
  • 3′ cloning site ligation-independent cloning (unknown if destroyed)
  • 5′ sequencing primer Polyhedrin forward, pFBOH-Fwd (CCGGATTATTCATACCGTCCCACC A)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    WDR61 was a gift from Cheryl Arrowsmith (Addgene plasmid # 28162 ; ; RRID:Addgene_28162)