1
Plasmid 29771: pET mCitrine LIC cloning vector (u-mCitrine)
  • None

  • mCitrine

  • C terminal on backbone

  • pET
    (Search Vector Database)

  • Bacterial Expression

  • 5481

  • LIC site vuGFP

  • Yes

  • LIC site vuGFP

  • Yes

  • T7 forward List of Sequencing Primers

  • GFP reverse (5'gcaccttgaagcgcatgaact)

  • Ampicillin

  • DH5alpha

  • 37

  • Low Copy

  • View sequences (2)
  • View map

  • Scott Gradia

  • MTA
    EMD Millipore Limited Use Label License/Brookhaven pET Assurance Letter

Comments: 

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. This plasmid can be used as a single-expression vector, and it is also compatible with our 2-series polycistronic destination vectors (2D, 2E, and 2Z), if co-expression with other genes is desired.

mCitrine has a excitation max of 515 nm and an emission max of 529 nm.

To clone into this vector, add LIC tags to the 5' end of your PCR primers.

Forward - 5' TTTAAGAAGGAGATATAGATC3'

Reverse - 5' GTTGGAGGATGAGAGGATCCC 3'

Do NOT include a stop codon with your reverse primer.

Linearize the plasmid with EcoRV, then gel purify.

When digesting the DNA with T4 polymerase, use dGTP for the insert and dCTP for your linearized vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 29771" in your Materials and Methods section.