-
Purpose(Empty Backbone)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 30116 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFastBac
- Backbone size (bp) 5976
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
-
Tag
/ Fusion Protein
- His6-MBP-N10-TEV (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site LIC site (destroyed during cloning)
- 3′ cloning site LIC site (destroyed during cloning)
- 5′ sequencing primer MBP F (5'ggtcgtcagactgtcgatgaagcc)
- 3′ sequencing primer LICBac R (5'caggttcagggggaggtgtg) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.
This vector will add a His6-MBP-N10-TEV sequence to the N terminus of your protein. MBP may improve the solubility of your protein.
Add the following tags to your PCR primers:
LicV1 Forward Tag TACTTCCAATCCAATGCA
LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA
Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.
For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBac His6 MBP N10 TEV LIC cloning vector (4C) was a gift from Scott Gradia (Addgene plasmid # 30116 ; http://n2t.net/addgene:30116 ; RRID:Addgene_30116)