1
Plasmid 30111: pFastBac LIC cloning vector (4A)
  • None

  • pFastBac
    (Search Vector Database)

  • Insect Expression

  • 4816

  • LIC site

  • Yes

  • LIC site

  • Yes

  • LICBac F (5'gtggttggctacgtatactccgg) List of Sequencing Primers

  • LICBac R (5'caggttcagggggaggtgtg)

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Gentamicin

  • View sequences (2)
  • Scott Gradia

  • UBMTA

Comments: 

This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.

Add the following tags to your PCR primers:

LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)

LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA

Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.

For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 30111" in your Materials and Methods section.