Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pFastBac LIC cloning vector (4A)
(Plasmid #30111)

Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pFastBac
  • Backbone size (bp) 4816
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC site (destroyed during cloning)
  • 3′ cloning site LIC site (destroyed during cloning)
  • 5′ sequencing primer LICBac F (5'gtggttggctacgtatactccgg)
  • 3′ sequencing primer LICBac R (5'caggttcagggggaggtgtg)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

This plasmid is a LIC-adapted pFastBac vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.

Add the following tags to your PCR primers:

LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)

LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA

Linearize this plasmid with SspI and gel purify the product, then T4-treat with dGTP. For the PCR product, T4-treat with dCTP.

For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBac LIC cloning vector (4A) was a gift from Scott Gradia (Addgene plasmid # 30111)