pFastBac Dual LIC cloning vector (5A)
(Plasmid #30121)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pFastBac Dual
  • Backbone size (bp) 5279
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC site (destroyed during cloning)
  • 3′ cloning site LIC site (destroyed during cloning)
  • 5′ sequencing primer see notes
  • 3′ sequencing primer see notes
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

This plasmid is a LIC-adapted pFastBac Dual vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.

This vector is a dual expression vector, and your 2 genes can be inserted in any order (check your gene for internal restriction sites, as this may dictate cloning order).

LIC site v1:
Add the following tags to your PCR primers:

LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)

LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA

Linearize vector with SspI and gel purify. T4-treat vector with dGTP. For the PCR product, T4-treat with dCTP.

LIC site v2

LicV2 Forward Tag TTTAAGAAGGAGATATAGATC(ATG)

LicV2 Reverse Tag TTATGGAGTTGGGATCTTATTA

Linearize vector with EcoRV and gel purify. T4-treat vector with dCTP. For the PCR product, T4-treat with dGTP.

To sequence LIC site v1, use the following primers:

LicBac dual V1 F cctataactattccggattattcataccgtc
LicBac dual V1 R caggttcagggggaggtgtg

To sequence LIC site v2, use the following primers:

LicBac dual V2 F gtcatagcgcgggttccttcc
LicBac dual V2 R ggagtatacggacctttaattcaaccc

For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBac Dual LIC cloning vector (5A) was a gift from Scott Gradia (Addgene plasmid # 30121)