1
Plasmid 30121: pFastBac Dual LIC cloning vector (5A)
  • None

  • pFastBac Dual
    (Search Vector Database)

  • Insect Expression

  • 5279

  • LIC site

  • Yes

  • LIC site

  • Yes

  • see notes List of Sequencing Primers

  • see notes

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Gentamicin

  • View sequences (2)
  • Scott Gradia

  • UBMTA

Comments: 

This plasmid is a LIC-adapted pFastBac Dual vector. It uses the same PCR primer tags as with most of our other vectors, so one PCR product can be inserted into many different vectors at once.

This vector is a dual expression vector, and your 2 genes can be inserted in any order (check your gene for internal restriction sites, as this may dictate cloning order).

LIC site v1:
Add the following tags to your PCR primers:

LicV1 Forward Tag TACTTCCAATCCAATGCA(ATG)

LicV1 Reverse Tag TTATCCACTTCCAATGTTATTA

Linearize vector with SspI and gel purify. T4-treat vector with dGTP. For the PCR product, T4-treat with dCTP.

LIC site v2

LicV2 Forward Tag TTTAAGAAGGAGATATAGATC(ATG)

LicV2 Reverse Tag TTATGGAGTTGGGATCTTATTA

Linearize vector with EcoRV and gel purify. T4-treat vector with dCTP. For the PCR product, T4-treat with dGTP.

To sequence LIC site v1, use the following primers:

LicBac dual V1 F cctataactattccggattattcataccgtc
LicBac dual V1 R caggttcagggggaggtgtg

To sequence LIC site v2, use the following primers:

LicBac dual V2 F gtcatagcgcgggttccttcc
LicBac dual V2 R ggagtatacggacctttaattcaaccc

For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 30121" in your Materials and Methods section.