1
Plasmid 31178: Monomer NK
  • Monomer-NK

  • TALE Monomer NK

  • 102

  • Xanthomonas

  • pJ201
    (Search Vector Database)

  • Bacterial Expression

  • 2672

  • GATGGTAGTGTGGGGACTCC List of Sequencing Primers

  • Kanamycin

  • DH5alpha

  • 37

  • High Copy

  • DNA 2.0

  • View sequences (2)
  • Feng Zhang

  • UBMTA

Comments: 

Please visit www.taleffectors.com for detailed protocols and plasmid maps.

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 31178" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only