1
Plasmid 31178: Monomer NK
  • Monomer-NK

  • TALE Monomer NK

  • 102

  • Xanthomonas

  • pJ201
    (Search Vector Database)

  • Bacterial Expression

  • 2672

  • GATGGTAGTGTGGGGACTCC List of Sequencing Primers

  • Kanamycin

  • DH5alpha

  • 37

  • High Copy

  • DNA 2.0

  • View sequences (2)
  • Feng Zhang

  • MTA

Comments: 

Please visit www.taleffectors.com for detailed protocols and plasmid maps.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 31178" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only