Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pAdEasy-Msln-iCre-HA-Flag
(Plasmid #31305)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31305 Plasmid sent as bacteria in agar stab 1 $65 Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pAdEasy
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 33000
  • Vector type
    Adenoviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Mesothelin
  • Alt name
    Msln
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1850
  • Entrez Gene
    MSLN (a.k.a. MPF, SMRP)
  • Tags / Fusion Proteins
    • Flag (C terminal on insert)
    • HA (C terminal on insert)

Cloning Information

Resource Information

  • Terms and Licenses

Depositor Comments

Msln Promoter sequence provided by author (see above link)

Please note that Addgene was unable to sequence verify this plasmid. The depositing laboratory PCR amplified two regions of this plasmid using the following primer pairs and sequenced the resulting PCR products to confirm the plasmid.

Msln-1F: TCATTTGTTCCCTTTGACGGC
Msln-1R: CTCTCCCCAGCATCCACATTC
Expect 987 nt product

Msln-2F: TTGCCTACAACACCCTGCTGCG
Msln-2R: GCTCACAATGCTTCCATCAAACG
Expect 792 nt product

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAdEasy-Msln-iCre-HA-Flag was a gift from William Pu (Addgene plasmid # 31305)
  • For your References section:

    Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. Zhou B, Honor LB, He H, Ma Q, Oh JH, Butterfield C, Lin RZ, Melero-Martin JM, Dolmatova E, Duffy HS, Gise A, Zhou P, Hu YW, Wang G, Zhang B, Wang L, Hall JL, Moses MA, McGowan FX, Pu WT. J Clin Invest. 2011 May 2. 121(5):1894-904. 10.1172/JCI45529 PubMed 21505261