Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDEST40-MCU-V5-HIS
(Plasmid #31731)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31731 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDEST40-pcDNA
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5485
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10/P3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MCU
  • Alt name
    CCDC109A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1056
  • GenBank ID
    NM_138357
  • Entrez Gene
    MCU (a.k.a. C10orf42, CCDC109A, HsMCU)
  • Promoter CMV
  • Tag / Fusion Protein
    • V5-HIS6X (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer CGTAGAATCGAGACCGAGGAG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Articles Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST40-MCU-V5-HIS was a gift from Vamsi Mootha (Addgene plasmid # 31731 ; http://n2t.net/addgene:31731 ; RRID:Addgene_31731)
  • For your References section:

    Integrative genomics identifies MCU as an essential component of the mitochondrial calcium uniporter. Baughman JM, Perocchi F, Girgis HS, Plovanich M, Belcher-Timme CA, Sancak Y, Bao XR, Strittmatter L, Goldberger O, Bogorad RL, Koteliansky V, Mootha VK. Nature. 2011 Jun 19. ():. 10.1038/nature10234 PubMed 21685886