1
Plasmid 32001: mCherry-SEpHluorin
  • mCherry

  • 902

  • Superecliptic pHluorin

  • C terminal on backbone

  • pEGFP-N1
    (Search Vector Database)

  • Clontech

  • Mammalian Expression

  • The EGFP coding region from the EGFP-N1 vector was replaced with a PCR product containing the SEpHluorin coding region flanked by BamHI and NotI restriction sites.

  • EcoRI

  • No

  • BamHI

  • No

  • 5'd[CGTCGCCGTCCAGCTCGACCAG]3' List of Sequencing Primers

  • Kanamycin

  • DH5alpha

  • 37

  • Unknown

  • View sequences (3)
  • Sergio Grinstein

  • MTA
    Clontech Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Amiloride inhibits macropinocytosis by lowering submembranous pH and preventing Rac1 and Cdc42 signaling. Koivusalo et al (J Cell Biol. 2010 Feb 22;188(4):547-63. Epub 2010 Feb 15. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32001" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only