Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open and shipping orders.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

mCherry-SEpHluorin
(Plasmid #32001)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32001 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Modifications to backbone
    The EGFP coding region from the EGFP-N1 vector was replaced with a PCR product containing the SEpHluorin coding region flanked by BamHI and NotI restriction sites.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    902
  • Tag / Fusion Protein
    • Superecliptic pHluorin (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer 5'd[CGTCGCCGTCCAGCTCGACCAG]3'
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCherry-SEpHluorin was a gift from Sergio Grinstein (Addgene plasmid # 32001 ; http://n2t.net/addgene:32001 ; RRID:Addgene_32001)
  • For your References section:

    Amiloride inhibits macropinocytosis by lowering submembranous pH and preventing Rac1 and Cdc42 signaling. Koivusalo M, Welch C, Hayashi H, Scott CC, Kim M, Alexander T, Touret N, Hahn KM, Grinstein S. J Cell Biol. 2010 Feb 22;188(4):547-63. Epub 2010 Feb 15. 10.1083/jcb.200908086 PubMed 20156964