Lyn-tailed mCherry-SEpHluorin
(Plasmid #32002)

• Depositing Lab: Sergio Grinstein
• Publication: Koivusalo et al J Cell Biol. 2010 Feb 22;188(4):547-63. Epub 2010 Feb 15.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Modifications to backbone: Membrane-targeted SuperEcliptic (SE) pHluorin/mCherry was generated by first constructing a chimeric construct consisting of the green, pH-sensitive fluorescent protein SuperEcliptic (SE) pHluorin co-fused to the red, pH-insensitive mCherry The EGFP coding region from the EGFP-N1 vector (Clontech, Mountain View, CA) was replaced with a PCR product containing the SEpHluorin coding region flanked by BamHI and NotI restriction sites. The PCR product of the mCherry coding sequence was inserted at the EcoRI and BamHI sites. The probe was targeted to the plasma membrane by inclusion of the N-terminal motif of the Src-family kinase Lyn. The membrane targeting sequence of Lyn was inserted between XhoI and EcoRI sites. The forward and reverse oligonucleotide sequences for the Lyn membrane targeting sequence were 5’-TCGAGAGAAATATGGGATGTATTAAATCAAAAAGGAAAGACGGGAG and 5’-AATTCTCCCGTCTTTCCTTTTTGATTTAATACATCCCATATTTCTC, respectively
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Membrane-targeting sequence of Lyn kinase

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: 5'd[CGTCGCCGTCCAGCTCGACCAG]3'

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry