1
Plasmid 32002: Lyn-tailed mCherry-SEpHluorin
  • Membrane-targeting sequence of Lyn kinase

  • pEGFP-N1
    (Search Vector Database)

  • Clontech

  • Mammalian Expression

  • Membrane-targeted SuperEcliptic (SE) pHluorin/mCherry was generated by first constructing a chimeric construct consisting of the green, pH-sensitive fluorescent protein SuperEcliptic (SE) pHluorin co-fused to the red, pH-insensitive mCherry The EGFP coding region from the EGFP-N1 vector (Clontech, Mountain View, CA) was replaced with a PCR product containing the SEpHluorin coding region flanked by BamHI and NotI restriction sites. The PCR product of the mCherry coding sequence was inserted at the EcoRI and BamHI sites. The probe was targeted to the plasma membrane by inclusion of the N-terminal motif of the Src-family kinase Lyn. The membrane targeting sequence of Lyn was inserted between XhoI and EcoRI sites. The forward and reverse oligonucleotide sequences for the Lyn membrane targeting sequence were 5’-TCGAGAGAAATATGGGATGTATTAAATCAAAAAGGAAAGACGGGAG and 5’-AATTCTCCCGTCTTTCCTTTTTGATTTAATACATCCCATATTTCTC, respectively

  • XhoI

  • No

  • EcoRI

  • No

  • 5'd[CGTCGCCGTCCAGCTCGACCAG]3' List of Sequencing Primers

  • Kanamycin

  • DH5alpha

  • 37

  • Unknown

  • View sequences (3)
  • Sergio Grinstein

  • MTA
    Clontech Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Amiloride inhibits macropinocytosis by lowering submembranous pH and preventing Rac1 and Cdc42 signaling. Koivusalo et al (J Cell Biol. 2010 Feb 22;188(4):547-63. Epub 2010 Feb 15. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32002" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only