-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32148 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBDP
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Top10/P3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehsFlp1
-
SpeciesS. cerevisiae (budding yeast)
-
MutationAspartic Acid at Amino Acid 5
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site Avr2 (not destroyed)
- 5′ sequencing primer pBDP F : AAATAGGGGTTCCGCGCACAT
- 3′ sequencing primer pBDP R : ATAATGGTGCAGGGCGCTGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBPhsFlp1 was a gift from Gerald Rubin (Addgene plasmid # 32148 ; http://n2t.net/addgene:32148 ; RRID:Addgene_32148) -
For your References section:
Multiple new site-specific recombinases for use in manipulating animal genomes. Nern A, Pfeiffer BD, Svoboda K, Rubin GM. Proc Natl Acad Sci U S A. 2011 Aug 9. 10.1073/pnas.1111704108 PubMed 21831835