1
Plasmid 32568: punc-119cbr
  • unc-119

  • 2155

  • C. briggsae

  • U45326.1

  • punc-119c
    (Search Vector Database)

  • Worm Expression

  • 1413

  • PstI

  • No

  • SalI

  • No

  • GTAACATCAGAGATTTTGAGACAC List of Sequencing Primers

  • Kanamycin

  • Pir1

  • 37

  • High Copy

  • unc-119 (C. briggsae)

  • C. briggsae unc-119 gene was PCR amplified from pCFJ151.

  • View sequences (2)
  • Al Fisher

  • UBMTA

Comments: 

Plasmid is similar to punc-119c but has C. briggsae unc-119 genomic DNA in place of C. elegans unc-119 promoter and cDNA.

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32568" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with
26955: pID2.02
38148: pPK605