1
Plasmid 32568: punc-119cbr
  • unc-119

  • 2155

  • C. briggsae

  • U45326.1

  • punc-119c
    (Search Vector Database)

  • Worm Expression

  • 1413

  • PstI

  • No

  • SalI

  • No

  • GTAACATCAGAGATTTTGAGACAC List of Sequencing Primers

  • Kanamycin

  • Pir1

  • 37

  • High Copy

  • unc-119 (C. briggsae)

  • C. briggsae unc-119 gene was PCR amplified from pCFJ151.

  • View sequences (2)
  • Al Fisher

  • MTA

Comments: 

Plasmid is similar to punc-119c but has C. briggsae unc-119 genomic DNA in place of C. elegans unc-119 promoter and cDNA.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32568" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with
26955: pID2.02
38148: pPK605