(Plasmid #32568)

Available to Academic and Nonprofits Only


  • Vector backbone
  • Backbone size w/o insert (bp) 1413
  • Vector type
    Worm Expression
  • Selectable markers
    unc-119 (C. briggsae)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Sequence Information


  • Gene/Insert name
  • Species
    C. briggsae
  • Insert Size (bp)
  • GenBank ID

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GTAACATCAGAGATTTTGAGACAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    C. briggsae unc-119 gene was PCR amplified from pCFJ151.
  • Terms and Licenses

Depositor Comments

Plasmid is similar to punc-119c but has C. briggsae unc-119 genomic DNA in place of C. elegans unc-119 promoter and cDNA.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    punc-119cbr was a gift from Al Fisher (Addgene plasmid # 32568)