1
Plasmid 32704: pMSCV-FLIP-puro-dsRed-GFP-miRNA
  • emGFP-miRNA

  • It is a vector for cloning new miRNA.

  • MSCV
    (Search Vector Database)

  • Richard O. Hynes group

  • Mammalian Expression, Retroviral, RNAi, Cre/Lox

  • 1) GFP to dsRed 2) Thy1.1-mir30 to emGFP-miR (Invitrogen)

  • Ligation Independent Cloning

  • CTCCCACAACGAGGACTACAC List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • The depositor notes that XL1-Blue is also ok for general purpose use.

  • Unknown

  • Puromycin

  • View sequences (4)
  • View map

  • Hans Clevers

  • MTA
    Clontech Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Controlled gene expression in primary Lgr5 organoid cultures. Koo et al (Nat Methods. 2011 Dec 4. doi: 10.1038/nmeth.1802. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32704" in your Materials and Methods section.