1
Plasmid 32702: pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE
  • Conditional overexpression vector. Deletion of dsRed by Cre recombinase results in the rapid loss of dsRed and the activation of your gene fused to eGFP expression.

  • eGFP

  • 720

  • MSCV
    (Search Vector Database)

  • Clontech

  • Mammalian Expression, Retroviral, Cre/Lox

  • 6295

  • loxp-dsRed-loxp-MCS-eGFP seq is inserted.

  • Ligation Independent Cloning

  • CTCCCACAACGAGGACTACAC List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • The depositor notes that XL1-Blue is also ok for general purpose use.

  • Unknown

  • Puromycin

  • View sequences (4)
  • View map

  • In fusion cloning in pMSCV-loxp-dsRed-loxp vectors (application/pdf)

  • Hans Clevers

  • MTA
    Clontech Limited Use Label License

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Controlled gene expression in primary Lgr5 organoid cultures. Koo et al (Nat Methods. 2011 Dec 4. doi: 10.1038/nmeth.1802. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32702" in your Materials and Methods section.