Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pN1 Lck-GCaMP5G
(Plasmid #34924)


Item Catalog # Description Quantity Price (USD)
Plasmid 34924 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 3950
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    Lck-GCaMP3-T302L R303P D380Y
  • Insert Size (bp)
  • Mutation
    Plasmid contains N-terminal 26 amino acid membrane targeting sequence of Lck (Src tyrosine kinase) fused to GCaMP5G (GCaMP3-T302L R303P D380Y).
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ACGGTGGGAGGTCTATATAAGCAG AG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Lck-GCaMP5G was created using Lck-GCaMP3 ( described previously by the Khakh lab, and cytosolic GCaMP5G provided by the Kim lab (
  • Terms and Licenses
  • Articles Citing this Plasmid

Depositor Comments

Lck-GCaMP5G is a fusion between the Lck domain ( and cytosolic GCaMP5G ( This construct targets GCaMP5G to the plasma membrane.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pN1 Lck-GCaMP5G was a gift from Baljit Khakh (Addgene plasmid # 34924 ; ; RRID:Addgene_34924)
  • For your References section:

    Optimization of a GCaMP calcium indicator for neural activity imaging. Akerboom J, Chen TW, Wardill TJ, Tian L, Marvin JS, Mutlu S, Calderon NC, Esposti F, Borghuis BG, Sun XR, Gordus A, Orger MB, Portugues R, Engert F, Macklin JJ, Filosa A, Aggarwal A, Kerr RA, Takagi R, Kracun S, Shigetomi E, Khakh BS, Baier H, Lagnado L, Wang SS, Bargmann CI, Kimmel BE, Jayaraman V, Svoboda K, Kim DS, Schreiter ER, Looger LL. J Neurosci. 2012 Oct 3;32(40):13819-40. doi: 10.1523/JNEUROSCI.2601-12.2012. 10.1523/JNEUROSCI.2601-12.2012 PubMed 23035093