1
Plasmid 35296: pBbE4c-RFP
  • RFP

  • JBEI Part ID: JPUB_000062

  • 678

  • Synthetic

  • pBb
    (Search Vector Database)

  • Bacterial Expression

  • 3737

  • ProE

  • jkRFP-R (gctttggaaccgtactggaa) List of Sequencing Primers

  • jkRFP-F (tggtcactacgacgctgaag)

  • Chloramphenicol

  • DH5alpha

  • 37

  • High Copy

  • View sequences (3)
  • Jay Keasling

  • MTA

Comments: 

JBEI Part ID: JPUB_000062; Origin: colE1

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: BglBrick vectors and datasheets: A synthetic biology platform for gene expression. Lee et al (J Biol Eng. 2011 Sep 20;5:12. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35296" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only