1
Plasmid 35513: pLenti-CaMKIIa-eArchT 3.0-EYFP
  • eArchT 3.0-EYFP

  • 1548

  • Halorubrum sp. TP009

  • EYFP

  • C terminal on insert

  • Enhanced trafficking signal and ER export signal added

  • pLenti
    (Search Vector Database)

  • Mammalian Expression, Lentiviral

  • 9245

  • Addition of a CaMKIIa promoter and a WPRE

  • CaMKIIa

  • BamHI

  • No

  • EcoRI

  • No

  • AGTCCTGCAGTATTGTGTAT List of Sequencing Primers

  • GCAATAGCATGATACAAAGG

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • ArchT as reported by the Boyden Lab was synthesized by DNA 2.0 and fused with EYFP

  • View sequences (3)
  • View map

  • Karl Deisseroth

  • MTA

Comments: 

The enhanced trafficking signals allow for better membrane targeting in mammalian cells resulting in 3-5 fold increase in currents.

Please note that there may be several sequence discrepancies between depositor's reference sequence and Addgene's quality control sequence. These changes are in vector regions only and should not affect plasmid function.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Principles for applying optogenetic tools derived from direct comparative analysis of microbial opsins. Mattis et al (Nat Methods. 2011 Dec 18;9(2):159-72. doi: 10.1038/nmeth.1808. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35513" in your Materials and Methods section.