pAAVf-EnhCB-lacZnls miR-122 3x
(Plasmid
#35644)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 35644 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAVf-EnhCB-lacZnls
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3 miR-122 target sites
-
SpeciesSynthetic
-
Insert Size (bp)69
- Promoter CB
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstBI (not destroyed)
- 3′ cloning site BstBI (not destroyed)
- 5′ sequencing primer TGAAGCTGAAGCCTGTGATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVf-EnhCB-lacZnls miR-122 3x was a gift from Phillip Zamore (Addgene plasmid # 35644 ; http://n2t.net/addgene:35644 ; RRID:Addgene_35644)