This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

psiCHECK-2 3xmiR-122T
(Plasmid #35672)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 35672 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    psiCHECK-2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6273
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    3 miR-122 target sites
  • Insert Size (bp)
    69
  • Promoter HSV-TK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (destroyed during cloning)
  • 3′ cloning site PmeI (destroyed during cloning)
  • 5′ sequencing primer cccggaagaaatatatttgca
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCHECK-2 3xmiR-122T was a gift from Phillip Zamore (Addgene plasmid # 35672 ; http://n2t.net/addgene:35672 ; RRID:Addgene_35672)